Search results
1. Sugar and phosphate groups form the side of each new strand. 2. DNA unzips. 3. The bases attach from a supply in the cytoplasm. 4. DNA unwinds.
- DNA and RNA | 208 plays - Quizizz
DNA and RNA quiz for 9th grade students. Find other quizzes...
- DNA, RNA, Protein Synthesis Practice Test | 4.1K plays - Quizizz
During protein synthesis, amino acids in the cytoplasm are...
- DNA and RNA | 208 plays - Quizizz
Ta tabela rankingowa została wyłączona, ponieważ Twoje opcje różnią się od opcji właściciela materiału. Przywróć poprzednie opcje. Test jest szablonem otwartym. Nie generuje wyników w tabeli rankingowej. Więcej formatów pojawi się podczas wykonywania ćwiczenia. 1) DNA to... 2) DNA, do ACGA 3) RNA 4) RNA to... 5) DNA ma...
DNA and RNA quiz for 9th grade students. Find other quizzes for and more on Quizizz for free!
During protein synthesis, amino acids in the cytoplasm are picked up by molecules of __________ and taken to the ribosome. If one side of the helix is CACTGG, the complementary side would be. As part of its structure, a known gene contains the base sequence AATCGA.
24 kwi 2024 · Level up your studying with AI-generated flashcards, summaries, essay prompts, and practice tests from your own notes. Sign up now to access DNA vs RNA Worksheet materials and AI-powered study resources.
PART 1 DNA-RNA-PROTEIN SYNTHESIS - Quiz. 1) What are the three parts of a nucleotide? a) Ribose, and Nitrogen b) Uracil, Nitrogen, and Guanine c) sugar, phosphate, and base d) Cytokinesis, Uracil, and Thymine 2) What two scientist discovered DNA?
Study with Quizlet and memorize flashcards containing terms like DNA strand A: TACGCCCTCATACCTACCGAGATC, What are the monomers of a DNA molecule called?, Draw a diagram representing a DNA monomer and label the three parts. and more.
